a scientist has discovered a human gene from cancer cells. the nucleotide sequence of the template strand of the gene was determined as written below: 3’gacacgtacgagcctggacaccttaagagcgggctcggaacactggccccgattgacac5′ (a) study the nucleotide sequence of the template strand and write sense strand (showing direction) of the gene. (b) write down the mrna produces from this gene. (c) how many amino acids will be present in the protein product of this gene. (d) write amino acid sequence of the polypeptide

One of Sun Appliance’s products is a dishwasher. Two processing departments are involved in the dishwasher’s manufacture. The tub is assembled in one department, and a second department assembles and installs the motor. There is no beginning or ending work in process in either department. During March, the company incurred the following costs in the manufacture of 4,000 dishwashers. Tub Department Motor Department Direct materials $ 150,000 $ 96,000 Direct labor 12,000 18,000 Manufacturing overhead 18,000 6,000 Complete a production cost report for the Motor Department of Sun Appliance for March. (Round your Costs per equivalent units to 2 decimal places. Leave no cells blank – be certain to enter “0” wherever required. Omit the “$” sign in your response.) Motor Department of Sun Appliance Product Cost Report For the month of March Part I. Physical Flow Total Units Inputs: • Beginning WIP • Started Dishwashers to account for: Outputs: • Units completed • Ending WIP Dishwashers accounted for: Part II. Equivalent Units Direct Materials Conversion Costs Based on monthly input: • Beginning WIP • Units started Equivalent units of input Based on monthly output: • Units completed • Ending WIP Equivalent units of output Part III. Cost Per Equivalent Unit Total Unit Cost Direct Materials Conversion Costs Costs from Tub Department $ $ Costs from Motor Department TOTAL $ $ Divide by equivalent units Costs per equivalent unit $ $ $ Part IV. Total Cost Assignment Total Costs Direct Materials Conversion Costs Costs to account for: • Cost of beginning WIP $ • Cost added during the period Total cost to account for $ Costs accounted for: • Cost of goods transferred Beginning WIP last period $ $ $ Beginning WIP this period Started and completed Total cost transferred $ $ $ • Add ending WIP Total cost accounted for $ $ $

If at all possible I need this essay completed by 11 pm 2/20/2015. This assignment is for a communication research class.  when it says explain which theory was used, it means which theory of communication was used in the article.

 

Read the attached article.  Then explain the study (what theory is used, axioms of the theory, the background) AND provide a summary in about one page or two pages. Then follow it up by outlining the strengths and weaknesses of the research essentially talking about what you liked about the study and what you can take home from the study. 

 

Mla format

Double spaced

Write an eight- to ten-page paper, in which you compare and contrast two literary works from this course that share the same theme (using the “Themes & Corresponding Works” list, below, as a guide).

 

The paper should be organized around your thesis (argument), which is the main point of the entire essay. When developing a thesis for a comparative paper, consider how a comparison of the works provides deeper insight into the topic of your paper (i.e., think about why you have chosen to look at these particular works in relation to one another). In your analysis, consider the relationships among the following elements:

• Content
• Form (e.g., short story vs. poem)
• Style

Assignment Requirements

• Topic: Must address one of the topics in the guidelines
• Length: Your draft should be eight to ten double-spaced pages in length (excluding title and reference page)
• Sources: Utilize at least six scholarly sources to support your thesis (including the course text and at least two sources from the Ashford Online Library).
• APA: Your draft must be formatted to APA (6th edition) style.
  • Separate Title Page: Must include an original title
  • Separate Reference Page
  • Proper Citations: All sources must be properly cited, both within the text and in a separate reference page.
• Elements of Academic Writing:  All academic papers should include these elements.
  • Introduction with a thesis statement
  • Supporting paragraphs
  • Conclusion

Themes & Corresponding Works
Choose only two of the works within your selected theme.

• Race / Ethnicity
  • Country Lovers (Gordimer)
  • The Welcome Table (Walker)
  • What It’s Like to Be a Black Girl (Smith)
  • Child of the Americas (Morales)
• Gender Roles / Marriage
  • The Secret Life of Walter Mitty (Thurber)
  • The Story of an Hour (Chopin)
  • The Necklace (de Mauppassant)
  • The Proposal (Chekhov)
  • Country Lovers (Gordimer)
• Creativity / The Creative Process
  • Poetry (Neruda)
  • Constantly Risking Absurdity (Ferlinghetti)
  • You, Reader (Collins)
• Death and Impermanence
  • Dog’s Death (Updike)
  • I Used to Live Here Once (Rhys)
  • A Father’s Story (Dubus)
  • Do Not Go Gentle into that Good Night (Thomas)
  • Nothing Gold Can Stay (Frost)
  • In Memoriam (Tennyson)
  • Because I Could Not Stop for Death (Dickinson)
• Nature
  • Wild Geese (Oliver)
  • Dover Beach (Arnold)
  • The Oak (Tennyson)
  • The Road Not Taken (Frost)
• Symbolism of the Journey
  • The Road Not Taken (Frost)
  • A Worn Path (Welty)
  • I Used to Live Here Once (Rhys)